ID: 1004290142

View in Genome Browser
Species Human (GRCh38)
Location 6:14359271-14359293
Sequence TTACTACATACGGTAGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004290142_1004290148 17 Left 1004290142 6:14359271-14359293 CCTTCAGCTACCGTATGTAGTAA No data
Right 1004290148 6:14359311-14359333 CTTGGTCAACACTTATATAATGG No data
1004290142_1004290144 -1 Left 1004290142 6:14359271-14359293 CCTTCAGCTACCGTATGTAGTAA No data
Right 1004290144 6:14359293-14359315 ATGCTCCCCATAATGATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004290142 Original CRISPR TTACTACATACGGTAGCTGA AGG (reversed) Intergenic
No off target data available for this crispr