ID: 1004290143

View in Genome Browser
Species Human (GRCh38)
Location 6:14359281-14359303
Sequence ATGGGGAGCATTACTACATA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004290143_1004290148 7 Left 1004290143 6:14359281-14359303 CCGTATGTAGTAATGCTCCCCAT No data
Right 1004290148 6:14359311-14359333 CTTGGTCAACACTTATATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004290143 Original CRISPR ATGGGGAGCATTACTACATA CGG (reversed) Intergenic
No off target data available for this crispr