ID: 1004290145

View in Genome Browser
Species Human (GRCh38)
Location 6:14359298-14359320
Sequence GTTGACCAAGCATCATTATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004290145_1004290148 -10 Left 1004290145 6:14359298-14359320 CCCCATAATGATGCTTGGTCAAC No data
Right 1004290148 6:14359311-14359333 CTTGGTCAACACTTATATAATGG No data
1004290145_1004290151 28 Left 1004290145 6:14359298-14359320 CCCCATAATGATGCTTGGTCAAC No data
Right 1004290151 6:14359349-14359371 ATAATAGAGCTGCCCTATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004290145 Original CRISPR GTTGACCAAGCATCATTATG GGG (reversed) Intergenic
No off target data available for this crispr