ID: 1004290376

View in Genome Browser
Species Human (GRCh38)
Location 6:14361608-14361630
Sequence TCCAATAGGTCCCAAGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004290376_1004290381 17 Left 1004290376 6:14361608-14361630 CCTGTTTCTTGGGACCTATTGGA No data
Right 1004290381 6:14361648-14361670 AACAATGAGGCAATCAGAACAGG No data
1004290376_1004290379 4 Left 1004290376 6:14361608-14361630 CCTGTTTCTTGGGACCTATTGGA No data
Right 1004290379 6:14361635-14361657 AGAGGCCATTCTAAACAATGAGG No data
1004290376_1004290382 18 Left 1004290376 6:14361608-14361630 CCTGTTTCTTGGGACCTATTGGA No data
Right 1004290382 6:14361649-14361671 ACAATGAGGCAATCAGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004290376 Original CRISPR TCCAATAGGTCCCAAGAAAC AGG (reversed) Intergenic
No off target data available for this crispr