ID: 1004290772

View in Genome Browser
Species Human (GRCh38)
Location 6:14364883-14364905
Sequence AAGCTGTGACCATTATCGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004290767_1004290772 24 Left 1004290767 6:14364836-14364858 CCTTTTCTGCTCAAAATTAATAG No data
Right 1004290772 6:14364883-14364905 AAGCTGTGACCATTATCGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004290772 Original CRISPR AAGCTGTGACCATTATCGAG GGG Intergenic
No off target data available for this crispr