ID: 1004292053

View in Genome Browser
Species Human (GRCh38)
Location 6:14376441-14376463
Sequence CCGTGAAGCCTTCTGAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004292053_1004292057 4 Left 1004292053 6:14376441-14376463 CCTGCCCTCAGAAGGCTTCACGG No data
Right 1004292057 6:14376468-14376490 TTTTTCAAGTAAATCCTTACCGG No data
1004292053_1004292058 5 Left 1004292053 6:14376441-14376463 CCTGCCCTCAGAAGGCTTCACGG No data
Right 1004292058 6:14376469-14376491 TTTTCAAGTAAATCCTTACCGGG No data
1004292053_1004292060 21 Left 1004292053 6:14376441-14376463 CCTGCCCTCAGAAGGCTTCACGG No data
Right 1004292060 6:14376485-14376507 TACCGGGCTGACTGTGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004292053 Original CRISPR CCGTGAAGCCTTCTGAGGGC AGG (reversed) Intergenic
No off target data available for this crispr