ID: 1004292055

View in Genome Browser
Species Human (GRCh38)
Location 6:14376445-14376467
Sequence TAGACCGTGAAGCCTTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004292055_1004292060 17 Left 1004292055 6:14376445-14376467 CCCTCAGAAGGCTTCACGGTCTA No data
Right 1004292060 6:14376485-14376507 TACCGGGCTGACTGTGTTTCTGG No data
1004292055_1004292058 1 Left 1004292055 6:14376445-14376467 CCCTCAGAAGGCTTCACGGTCTA No data
Right 1004292058 6:14376469-14376491 TTTTCAAGTAAATCCTTACCGGG No data
1004292055_1004292057 0 Left 1004292055 6:14376445-14376467 CCCTCAGAAGGCTTCACGGTCTA No data
Right 1004292057 6:14376468-14376490 TTTTTCAAGTAAATCCTTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004292055 Original CRISPR TAGACCGTGAAGCCTTCTGA GGG (reversed) Intergenic
No off target data available for this crispr