ID: 1004292060

View in Genome Browser
Species Human (GRCh38)
Location 6:14376485-14376507
Sequence TACCGGGCTGACTGTGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004292052_1004292060 22 Left 1004292052 6:14376440-14376462 CCCTGCCCTCAGAAGGCTTCACG No data
Right 1004292060 6:14376485-14376507 TACCGGGCTGACTGTGTTTCTGG No data
1004292055_1004292060 17 Left 1004292055 6:14376445-14376467 CCCTCAGAAGGCTTCACGGTCTA No data
Right 1004292060 6:14376485-14376507 TACCGGGCTGACTGTGTTTCTGG No data
1004292056_1004292060 16 Left 1004292056 6:14376446-14376468 CCTCAGAAGGCTTCACGGTCTAT No data
Right 1004292060 6:14376485-14376507 TACCGGGCTGACTGTGTTTCTGG No data
1004292053_1004292060 21 Left 1004292053 6:14376441-14376463 CCTGCCCTCAGAAGGCTTCACGG No data
Right 1004292060 6:14376485-14376507 TACCGGGCTGACTGTGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004292060 Original CRISPR TACCGGGCTGACTGTGTTTC TGG Intergenic
No off target data available for this crispr