ID: 1004296440

View in Genome Browser
Species Human (GRCh38)
Location 6:14416090-14416112
Sequence CCACTCCTGGACTGTGCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004296432_1004296440 -4 Left 1004296432 6:14416071-14416093 CCCTTGGGGCCCTCTCTCCCCAC No data
Right 1004296440 6:14416090-14416112 CCACTCCTGGACTGTGCCATAGG No data
1004296428_1004296440 25 Left 1004296428 6:14416042-14416064 CCAGGCTAGAAAAACTTGAAATT No data
Right 1004296440 6:14416090-14416112 CCACTCCTGGACTGTGCCATAGG No data
1004296433_1004296440 -5 Left 1004296433 6:14416072-14416094 CCTTGGGGCCCTCTCTCCCCACT No data
Right 1004296440 6:14416090-14416112 CCACTCCTGGACTGTGCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004296440 Original CRISPR CCACTCCTGGACTGTGCCAT AGG Intergenic
No off target data available for this crispr