ID: 1004304527

View in Genome Browser
Species Human (GRCh38)
Location 6:14487894-14487916
Sequence ACAGAGAGACAACATTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004304522_1004304527 28 Left 1004304522 6:14487843-14487865 CCTCCTCTCTGCTGAGAGCTGCA 0: 69
1: 132
2: 201
3: 210
4: 426
Right 1004304527 6:14487894-14487916 ACAGAGAGACAACATTGGGATGG No data
1004304523_1004304527 25 Left 1004304523 6:14487846-14487868 CCTCTCTGCTGAGAGCTGCAGAT 0: 9
1: 88
2: 215
3: 485
4: 849
Right 1004304527 6:14487894-14487916 ACAGAGAGACAACATTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004304527 Original CRISPR ACAGAGAGACAACATTGGGA TGG Intergenic
No off target data available for this crispr