ID: 1004305608

View in Genome Browser
Species Human (GRCh38)
Location 6:14499374-14499396
Sequence CTTTGTAAGGCCAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004305608_1004305614 -8 Left 1004305608 6:14499374-14499396 CCTCCCACCTTGGCCTTACAAAG No data
Right 1004305614 6:14499389-14499411 TTACAAAGCGCTGGAATTACAGG No data
1004305608_1004305617 21 Left 1004305608 6:14499374-14499396 CCTCCCACCTTGGCCTTACAAAG No data
Right 1004305617 6:14499418-14499440 CCACCACACCTGGCCCACTTAGG No data
1004305608_1004305615 11 Left 1004305608 6:14499374-14499396 CCTCCCACCTTGGCCTTACAAAG No data
Right 1004305615 6:14499408-14499430 CAGGCGTAAGCCACCACACCTGG 0: 224
1: 6834
2: 39826
3: 122873
4: 212164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004305608 Original CRISPR CTTTGTAAGGCCAAGGTGGG AGG (reversed) Intergenic
No off target data available for this crispr