ID: 1004310354

View in Genome Browser
Species Human (GRCh38)
Location 6:14540043-14540065
Sequence GCCCGTATGAGGCTGGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004310354_1004310360 28 Left 1004310354 6:14540043-14540065 CCAGCGCCCAGCCTCATACGGGC No data
Right 1004310360 6:14540094-14540116 ATTCTGCTTCCTCCAGCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004310354 Original CRISPR GCCCGTATGAGGCTGGGCGC TGG (reversed) Intergenic
No off target data available for this crispr