ID: 1004310518

View in Genome Browser
Species Human (GRCh38)
Location 6:14540975-14540997
Sequence CCTAATAAGCAAGCAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004310504_1004310518 29 Left 1004310504 6:14540923-14540945 CCTCTGAGCCCGCCTAATTGGAG No data
Right 1004310518 6:14540975-14540997 CCTAATAAGCAAGCAGGGGAGGG No data
1004310505_1004310518 21 Left 1004310505 6:14540931-14540953 CCCGCCTAATTGGAGAGAATTGC No data
Right 1004310518 6:14540975-14540997 CCTAATAAGCAAGCAGGGGAGGG No data
1004310506_1004310518 20 Left 1004310506 6:14540932-14540954 CCGCCTAATTGGAGAGAATTGCA No data
Right 1004310518 6:14540975-14540997 CCTAATAAGCAAGCAGGGGAGGG No data
1004310507_1004310518 17 Left 1004310507 6:14540935-14540957 CCTAATTGGAGAGAATTGCAGTT No data
Right 1004310518 6:14540975-14540997 CCTAATAAGCAAGCAGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004310518 Original CRISPR CCTAATAAGCAAGCAGGGGA GGG Intergenic
No off target data available for this crispr