ID: 1004316776

View in Genome Browser
Species Human (GRCh38)
Location 6:14595537-14595559
Sequence GGCTGTTCCCTTATTTGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004316771_1004316776 19 Left 1004316771 6:14595495-14595517 CCTACAGAGGTCTTTTATCAACT No data
Right 1004316776 6:14595537-14595559 GGCTGTTCCCTTATTTGCGGTGG No data
1004316770_1004316776 26 Left 1004316770 6:14595488-14595510 CCTTTGGCCTACAGAGGTCTTTT No data
Right 1004316776 6:14595537-14595559 GGCTGTTCCCTTATTTGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004316776 Original CRISPR GGCTGTTCCCTTATTTGCGG TGG Intergenic
No off target data available for this crispr