ID: 1004319058

View in Genome Browser
Species Human (GRCh38)
Location 6:14618329-14618351
Sequence TGGATTATGGGGGACACGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004319048_1004319058 16 Left 1004319048 6:14618290-14618312 CCTGTTCAGGCCTCCTCTGGGCA No data
Right 1004319058 6:14618329-14618351 TGGATTATGGGGGACACGGATGG No data
1004319049_1004319058 6 Left 1004319049 6:14618300-14618322 CCTCCTCTGGGCACTATTAAGTC No data
Right 1004319058 6:14618329-14618351 TGGATTATGGGGGACACGGATGG No data
1004319050_1004319058 3 Left 1004319050 6:14618303-14618325 CCTCTGGGCACTATTAAGTCTAA No data
Right 1004319058 6:14618329-14618351 TGGATTATGGGGGACACGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004319058 Original CRISPR TGGATTATGGGGGACACGGA TGG Intergenic
No off target data available for this crispr