ID: 1004319325 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:14620506-14620528 |
| Sequence | CTTTCTATGCTGCAGTTTCT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1004319323_1004319325 | 25 | Left | 1004319323 | 6:14620458-14620480 | CCTGTGGTCTTGCACATTTCTCC | No data | ||
| Right | 1004319325 | 6:14620506-14620528 | CTTTCTATGCTGCAGTTTCTTGG | No data | ||||
| 1004319324_1004319325 | 4 | Left | 1004319324 | 6:14620479-14620501 | CCTCAGAAACTACAAGTTCTGAG | No data | ||
| Right | 1004319325 | 6:14620506-14620528 | CTTTCTATGCTGCAGTTTCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1004319325 | Original CRISPR | CTTTCTATGCTGCAGTTTCT TGG | Intergenic | ||
| No off target data available for this crispr | |||||