ID: 1004319325

View in Genome Browser
Species Human (GRCh38)
Location 6:14620506-14620528
Sequence CTTTCTATGCTGCAGTTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004319323_1004319325 25 Left 1004319323 6:14620458-14620480 CCTGTGGTCTTGCACATTTCTCC No data
Right 1004319325 6:14620506-14620528 CTTTCTATGCTGCAGTTTCTTGG No data
1004319324_1004319325 4 Left 1004319324 6:14620479-14620501 CCTCAGAAACTACAAGTTCTGAG No data
Right 1004319325 6:14620506-14620528 CTTTCTATGCTGCAGTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004319325 Original CRISPR CTTTCTATGCTGCAGTTTCT TGG Intergenic
No off target data available for this crispr