ID: 1004319371

View in Genome Browser
Species Human (GRCh38)
Location 6:14620809-14620831
Sequence GCTGGAGGAGCCGTGGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004319371_1004319382 17 Left 1004319371 6:14620809-14620831 CCAGCTGCCACGGCTCCTCCAGC No data
Right 1004319382 6:14620849-14620871 ACAGGGCTGCACCCTCAGGAAGG No data
1004319371_1004319377 -1 Left 1004319371 6:14620809-14620831 CCAGCTGCCACGGCTCCTCCAGC No data
Right 1004319377 6:14620831-14620853 CCTCCCAGTGGACTCAGAACAGG No data
1004319371_1004319378 0 Left 1004319371 6:14620809-14620831 CCAGCTGCCACGGCTCCTCCAGC No data
Right 1004319378 6:14620832-14620854 CTCCCAGTGGACTCAGAACAGGG No data
1004319371_1004319381 13 Left 1004319371 6:14620809-14620831 CCAGCTGCCACGGCTCCTCCAGC No data
Right 1004319381 6:14620845-14620867 CAGAACAGGGCTGCACCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004319371 Original CRISPR GCTGGAGGAGCCGTGGCAGC TGG (reversed) Intergenic