ID: 1004321799

View in Genome Browser
Species Human (GRCh38)
Location 6:14637528-14637550
Sequence TTGCATGGCAAGAGTGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004321799_1004321808 16 Left 1004321799 6:14637528-14637550 CCTTGCACACTCTTGCCATGCAA No data
Right 1004321808 6:14637567-14637589 GGGAGTTGATTGTTTTGTTTAGG No data
1004321799_1004321803 -5 Left 1004321799 6:14637528-14637550 CCTTGCACACTCTTGCCATGCAA No data
Right 1004321803 6:14637546-14637568 TGCAAGGGCCGACTCCCAATAGG No data
1004321799_1004321804 -4 Left 1004321799 6:14637528-14637550 CCTTGCACACTCTTGCCATGCAA No data
Right 1004321804 6:14637547-14637569 GCAAGGGCCGACTCCCAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004321799 Original CRISPR TTGCATGGCAAGAGTGTGCA AGG (reversed) Intergenic
No off target data available for this crispr