ID: 1004324043

View in Genome Browser
Species Human (GRCh38)
Location 6:14657468-14657490
Sequence CACAATGCTGATAGGGCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004324043_1004324048 3 Left 1004324043 6:14657468-14657490 CCAATAGCCCTATCAGCATTGTG No data
Right 1004324048 6:14657494-14657516 CTTAACTGAGTAGCAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004324043 Original CRISPR CACAATGCTGATAGGGCTAT TGG (reversed) Intergenic
No off target data available for this crispr