ID: 1004324048

View in Genome Browser
Species Human (GRCh38)
Location 6:14657494-14657516
Sequence CTTAACTGAGTAGCAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004324047_1004324048 -5 Left 1004324047 6:14657476-14657498 CCTATCAGCATTGTGGGACTTAA No data
Right 1004324048 6:14657494-14657516 CTTAACTGAGTAGCAGAGCCTGG No data
1004324046_1004324048 -4 Left 1004324046 6:14657475-14657497 CCCTATCAGCATTGTGGGACTTA No data
Right 1004324048 6:14657494-14657516 CTTAACTGAGTAGCAGAGCCTGG No data
1004324043_1004324048 3 Left 1004324043 6:14657468-14657490 CCAATAGCCCTATCAGCATTGTG No data
Right 1004324048 6:14657494-14657516 CTTAACTGAGTAGCAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004324048 Original CRISPR CTTAACTGAGTAGCAGAGCC TGG Intergenic
No off target data available for this crispr