ID: 1004324095

View in Genome Browser
Species Human (GRCh38)
Location 6:14658125-14658147
Sequence AGATGCAGTGAGTGAGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004324095_1004324097 -7 Left 1004324095 6:14658125-14658147 CCCAGCTCTCACTCACTGCATCT No data
Right 1004324097 6:14658141-14658163 TGCATCTCAGCCCAGCTCTCTGG No data
1004324095_1004324100 10 Left 1004324095 6:14658125-14658147 CCCAGCTCTCACTCACTGCATCT No data
Right 1004324100 6:14658158-14658180 CTCTGGTGTTTTCCTGCAGATGG No data
1004324095_1004324101 11 Left 1004324095 6:14658125-14658147 CCCAGCTCTCACTCACTGCATCT No data
Right 1004324101 6:14658159-14658181 TCTGGTGTTTTCCTGCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004324095 Original CRISPR AGATGCAGTGAGTGAGAGCT GGG (reversed) Intergenic
No off target data available for this crispr