ID: 1004327192

View in Genome Browser
Species Human (GRCh38)
Location 6:14686167-14686189
Sequence ACGACTTGACACACCTAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004327189_1004327192 -1 Left 1004327189 6:14686145-14686167 CCCGCTGCTGAACTAAGGCCTCA No data
Right 1004327192 6:14686167-14686189 ACGACTTGACACACCTAGCAAGG No data
1004327190_1004327192 -2 Left 1004327190 6:14686146-14686168 CCGCTGCTGAACTAAGGCCTCAC No data
Right 1004327192 6:14686167-14686189 ACGACTTGACACACCTAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004327192 Original CRISPR ACGACTTGACACACCTAGCA AGG Intergenic
No off target data available for this crispr