ID: 1004327192 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:14686167-14686189 |
Sequence | ACGACTTGACACACCTAGCA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1004327189_1004327192 | -1 | Left | 1004327189 | 6:14686145-14686167 | CCCGCTGCTGAACTAAGGCCTCA | No data | ||
Right | 1004327192 | 6:14686167-14686189 | ACGACTTGACACACCTAGCAAGG | No data | ||||
1004327190_1004327192 | -2 | Left | 1004327190 | 6:14686146-14686168 | CCGCTGCTGAACTAAGGCCTCAC | No data | ||
Right | 1004327192 | 6:14686167-14686189 | ACGACTTGACACACCTAGCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1004327192 | Original CRISPR | ACGACTTGACACACCTAGCA AGG | Intergenic | ||
No off target data available for this crispr |