ID: 1004327293

View in Genome Browser
Species Human (GRCh38)
Location 6:14686820-14686842
Sequence TTCTAAGTGGATAAAGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004327289_1004327293 -2 Left 1004327289 6:14686799-14686821 CCTGGGGGTTGGTGATTCCTGTT No data
Right 1004327293 6:14686820-14686842 TTCTAAGTGGATAAAGAGCAGGG No data
1004327282_1004327293 22 Left 1004327282 6:14686775-14686797 CCACAAACTTGTACTTGTTAGTG No data
Right 1004327293 6:14686820-14686842 TTCTAAGTGGATAAAGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004327293 Original CRISPR TTCTAAGTGGATAAAGAGCA GGG Intergenic
No off target data available for this crispr