ID: 1004328617

View in Genome Browser
Species Human (GRCh38)
Location 6:14700639-14700661
Sequence GTACATGAGGAGCAAAGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004328610_1004328617 16 Left 1004328610 6:14700600-14700622 CCAAGCATCAAGGTTGAGTCCAG No data
Right 1004328617 6:14700639-14700661 GTACATGAGGAGCAAAGGGTTGG No data
1004328613_1004328617 -3 Left 1004328613 6:14700619-14700641 CCAGGAAACAATAGAAGGATGTA No data
Right 1004328617 6:14700639-14700661 GTACATGAGGAGCAAAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004328617 Original CRISPR GTACATGAGGAGCAAAGGGT TGG Intergenic
No off target data available for this crispr