ID: 1004330171 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:14714024-14714046 |
Sequence | GGTTAAATTTTATTTGTCTA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1004330171_1004330173 | 7 | Left | 1004330171 | 6:14714024-14714046 | CCTTAGACAAATAAAATTTAACC | No data | ||
Right | 1004330173 | 6:14714054-14714076 | ATTGAGCAAATAATGATTCGTGG | No data | ||||
1004330171_1004330174 | 13 | Left | 1004330171 | 6:14714024-14714046 | CCTTAGACAAATAAAATTTAACC | No data | ||
Right | 1004330174 | 6:14714060-14714082 | CAAATAATGATTCGTGGATCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1004330171 | Original CRISPR | GGTTAAATTTTATTTGTCTA AGG (reversed) | Intergenic | ||