ID: 1004330171 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:14714024-14714046 |
| Sequence | GGTTAAATTTTATTTGTCTA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1004330171_1004330173 | 7 | Left | 1004330171 | 6:14714024-14714046 | CCTTAGACAAATAAAATTTAACC | No data | ||
| Right | 1004330173 | 6:14714054-14714076 | ATTGAGCAAATAATGATTCGTGG | No data | ||||
| 1004330171_1004330174 | 13 | Left | 1004330171 | 6:14714024-14714046 | CCTTAGACAAATAAAATTTAACC | No data | ||
| Right | 1004330174 | 6:14714060-14714082 | CAAATAATGATTCGTGGATCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1004330171 | Original CRISPR | GGTTAAATTTTATTTGTCTA AGG (reversed) | Intergenic | ||