ID: 1004330172

View in Genome Browser
Species Human (GRCh38)
Location 6:14714045-14714067
Sequence ATTATTTGCTCAATTAAACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004330172_1004330178 21 Left 1004330172 6:14714045-14714067 CCGAGTTTAATTGAGCAAATAAT No data
Right 1004330178 6:14714089-14714111 TTGAACCAGAATAGGTTGAGAGG No data
1004330172_1004330179 22 Left 1004330172 6:14714045-14714067 CCGAGTTTAATTGAGCAAATAAT No data
Right 1004330179 6:14714090-14714112 TGAACCAGAATAGGTTGAGAGGG No data
1004330172_1004330180 23 Left 1004330172 6:14714045-14714067 CCGAGTTTAATTGAGCAAATAAT No data
Right 1004330180 6:14714091-14714113 GAACCAGAATAGGTTGAGAGGGG No data
1004330172_1004330175 13 Left 1004330172 6:14714045-14714067 CCGAGTTTAATTGAGCAAATAAT No data
Right 1004330175 6:14714081-14714103 GGCAGCCCTTGAACCAGAATAGG No data
1004330172_1004330174 -8 Left 1004330172 6:14714045-14714067 CCGAGTTTAATTGAGCAAATAAT No data
Right 1004330174 6:14714060-14714082 CAAATAATGATTCGTGGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004330172 Original CRISPR ATTATTTGCTCAATTAAACT CGG (reversed) Intergenic
No off target data available for this crispr