ID: 1004330173

View in Genome Browser
Species Human (GRCh38)
Location 6:14714054-14714076
Sequence ATTGAGCAAATAATGATTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004330170_1004330173 25 Left 1004330170 6:14714006-14714028 CCTCTGTTAAAAGATACACCTTA No data
Right 1004330173 6:14714054-14714076 ATTGAGCAAATAATGATTCGTGG No data
1004330169_1004330173 26 Left 1004330169 6:14714005-14714027 CCCTCTGTTAAAAGATACACCTT No data
Right 1004330173 6:14714054-14714076 ATTGAGCAAATAATGATTCGTGG No data
1004330171_1004330173 7 Left 1004330171 6:14714024-14714046 CCTTAGACAAATAAAATTTAACC No data
Right 1004330173 6:14714054-14714076 ATTGAGCAAATAATGATTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004330173 Original CRISPR ATTGAGCAAATAATGATTCG TGG Intergenic
No off target data available for this crispr