ID: 1004330174

View in Genome Browser
Species Human (GRCh38)
Location 6:14714060-14714082
Sequence CAAATAATGATTCGTGGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004330172_1004330174 -8 Left 1004330172 6:14714045-14714067 CCGAGTTTAATTGAGCAAATAAT No data
Right 1004330174 6:14714060-14714082 CAAATAATGATTCGTGGATCAGG No data
1004330171_1004330174 13 Left 1004330171 6:14714024-14714046 CCTTAGACAAATAAAATTTAACC No data
Right 1004330174 6:14714060-14714082 CAAATAATGATTCGTGGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004330174 Original CRISPR CAAATAATGATTCGTGGATC AGG Intergenic
No off target data available for this crispr