ID: 1004332368

View in Genome Browser
Species Human (GRCh38)
Location 6:14733554-14733576
Sequence GAGGAGAGACTGCCTTCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004332364_1004332368 -4 Left 1004332364 6:14733535-14733557 CCACGAGACTGACTTCCCTGAGG No data
Right 1004332368 6:14733554-14733576 GAGGAGAGACTGCCTTCTAATGG No data
1004332363_1004332368 6 Left 1004332363 6:14733525-14733547 CCACTGGAATCCACGAGACTGAC No data
Right 1004332368 6:14733554-14733576 GAGGAGAGACTGCCTTCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004332368 Original CRISPR GAGGAGAGACTGCCTTCTAA TGG Intergenic
No off target data available for this crispr