ID: 1004332368 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:14733554-14733576 |
| Sequence | GAGGAGAGACTGCCTTCTAA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1004332364_1004332368 | -4 | Left | 1004332364 | 6:14733535-14733557 | CCACGAGACTGACTTCCCTGAGG | No data | ||
| Right | 1004332368 | 6:14733554-14733576 | GAGGAGAGACTGCCTTCTAATGG | No data | ||||
| 1004332363_1004332368 | 6 | Left | 1004332363 | 6:14733525-14733547 | CCACTGGAATCCACGAGACTGAC | No data | ||
| Right | 1004332368 | 6:14733554-14733576 | GAGGAGAGACTGCCTTCTAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1004332368 | Original CRISPR | GAGGAGAGACTGCCTTCTAA TGG | Intergenic | ||
| No off target data available for this crispr | |||||