ID: 1004332701

View in Genome Browser
Species Human (GRCh38)
Location 6:14736255-14736277
Sequence TCCACCTTGGATAAACTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004332701_1004332708 4 Left 1004332701 6:14736255-14736277 CCAGAGAGTTTATCCAAGGTGGA No data
Right 1004332708 6:14736282-14736304 ATCAAAGTGAAACAGAAGGGAGG No data
1004332701_1004332709 5 Left 1004332701 6:14736255-14736277 CCAGAGAGTTTATCCAAGGTGGA No data
Right 1004332709 6:14736283-14736305 TCAAAGTGAAACAGAAGGGAGGG No data
1004332701_1004332714 14 Left 1004332701 6:14736255-14736277 CCAGAGAGTTTATCCAAGGTGGA No data
Right 1004332714 6:14736292-14736314 AACAGAAGGGAGGGGTGGGGAGG No data
1004332701_1004332706 1 Left 1004332701 6:14736255-14736277 CCAGAGAGTTTATCCAAGGTGGA No data
Right 1004332706 6:14736279-14736301 CCCATCAAAGTGAAACAGAAGGG No data
1004332701_1004332710 6 Left 1004332701 6:14736255-14736277 CCAGAGAGTTTATCCAAGGTGGA No data
Right 1004332710 6:14736284-14736306 CAAAGTGAAACAGAAGGGAGGGG No data
1004332701_1004332711 9 Left 1004332701 6:14736255-14736277 CCAGAGAGTTTATCCAAGGTGGA No data
Right 1004332711 6:14736287-14736309 AGTGAAACAGAAGGGAGGGGTGG No data
1004332701_1004332712 10 Left 1004332701 6:14736255-14736277 CCAGAGAGTTTATCCAAGGTGGA No data
Right 1004332712 6:14736288-14736310 GTGAAACAGAAGGGAGGGGTGGG No data
1004332701_1004332704 0 Left 1004332701 6:14736255-14736277 CCAGAGAGTTTATCCAAGGTGGA No data
Right 1004332704 6:14736278-14736300 CCCCATCAAAGTGAAACAGAAGG No data
1004332701_1004332713 11 Left 1004332701 6:14736255-14736277 CCAGAGAGTTTATCCAAGGTGGA No data
Right 1004332713 6:14736289-14736311 TGAAACAGAAGGGAGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004332701 Original CRISPR TCCACCTTGGATAAACTCTC TGG (reversed) Intergenic
No off target data available for this crispr