ID: 1004332702

View in Genome Browser
Species Human (GRCh38)
Location 6:14736268-14736290
Sequence CACTTTGATGGGGTCCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004332702_1004332713 -2 Left 1004332702 6:14736268-14736290 CCAAGGTGGACCCCATCAAAGTG No data
Right 1004332713 6:14736289-14736311 TGAAACAGAAGGGAGGGGTGGGG No data
1004332702_1004332712 -3 Left 1004332702 6:14736268-14736290 CCAAGGTGGACCCCATCAAAGTG No data
Right 1004332712 6:14736288-14736310 GTGAAACAGAAGGGAGGGGTGGG No data
1004332702_1004332711 -4 Left 1004332702 6:14736268-14736290 CCAAGGTGGACCCCATCAAAGTG No data
Right 1004332711 6:14736287-14736309 AGTGAAACAGAAGGGAGGGGTGG No data
1004332702_1004332708 -9 Left 1004332702 6:14736268-14736290 CCAAGGTGGACCCCATCAAAGTG No data
Right 1004332708 6:14736282-14736304 ATCAAAGTGAAACAGAAGGGAGG No data
1004332702_1004332716 25 Left 1004332702 6:14736268-14736290 CCAAGGTGGACCCCATCAAAGTG No data
Right 1004332716 6:14736316-14736338 CCCCCTAACCCATAAGCTTAAGG No data
1004332702_1004332710 -7 Left 1004332702 6:14736268-14736290 CCAAGGTGGACCCCATCAAAGTG No data
Right 1004332710 6:14736284-14736306 CAAAGTGAAACAGAAGGGAGGGG No data
1004332702_1004332721 30 Left 1004332702 6:14736268-14736290 CCAAGGTGGACCCCATCAAAGTG No data
Right 1004332721 6:14736321-14736343 TAACCCATAAGCTTAAGGGTTGG No data
1004332702_1004332709 -8 Left 1004332702 6:14736268-14736290 CCAAGGTGGACCCCATCAAAGTG No data
Right 1004332709 6:14736283-14736305 TCAAAGTGAAACAGAAGGGAGGG No data
1004332702_1004332718 26 Left 1004332702 6:14736268-14736290 CCAAGGTGGACCCCATCAAAGTG No data
Right 1004332718 6:14736317-14736339 CCCCTAACCCATAAGCTTAAGGG No data
1004332702_1004332714 1 Left 1004332702 6:14736268-14736290 CCAAGGTGGACCCCATCAAAGTG No data
Right 1004332714 6:14736292-14736314 AACAGAAGGGAGGGGTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004332702 Original CRISPR CACTTTGATGGGGTCCACCT TGG (reversed) Intergenic
No off target data available for this crispr