ID: 1004332703

View in Genome Browser
Species Human (GRCh38)
Location 6:14736278-14736300
Sequence CCTTCTGTTTCACTTTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004332703_1004332714 -9 Left 1004332703 6:14736278-14736300 CCCCATCAAAGTGAAACAGAAGG No data
Right 1004332714 6:14736292-14736314 AACAGAAGGGAGGGGTGGGGAGG No data
1004332703_1004332721 20 Left 1004332703 6:14736278-14736300 CCCCATCAAAGTGAAACAGAAGG No data
Right 1004332721 6:14736321-14736343 TAACCCATAAGCTTAAGGGTTGG No data
1004332703_1004332718 16 Left 1004332703 6:14736278-14736300 CCCCATCAAAGTGAAACAGAAGG No data
Right 1004332718 6:14736317-14736339 CCCCTAACCCATAAGCTTAAGGG No data
1004332703_1004332722 21 Left 1004332703 6:14736278-14736300 CCCCATCAAAGTGAAACAGAAGG No data
Right 1004332722 6:14736322-14736344 AACCCATAAGCTTAAGGGTTGGG No data
1004332703_1004332716 15 Left 1004332703 6:14736278-14736300 CCCCATCAAAGTGAAACAGAAGG No data
Right 1004332716 6:14736316-14736338 CCCCCTAACCCATAAGCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004332703 Original CRISPR CCTTCTGTTTCACTTTGATG GGG (reversed) Intergenic
No off target data available for this crispr