ID: 1004332704

View in Genome Browser
Species Human (GRCh38)
Location 6:14736278-14736300
Sequence CCCCATCAAAGTGAAACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004332701_1004332704 0 Left 1004332701 6:14736255-14736277 CCAGAGAGTTTATCCAAGGTGGA No data
Right 1004332704 6:14736278-14736300 CCCCATCAAAGTGAAACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004332704 Original CRISPR CCCCATCAAAGTGAAACAGA AGG Intergenic
No off target data available for this crispr