ID: 1004332705

View in Genome Browser
Species Human (GRCh38)
Location 6:14736279-14736301
Sequence CCCTTCTGTTTCACTTTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004332705_1004332714 -10 Left 1004332705 6:14736279-14736301 CCCATCAAAGTGAAACAGAAGGG No data
Right 1004332714 6:14736292-14736314 AACAGAAGGGAGGGGTGGGGAGG No data
1004332705_1004332721 19 Left 1004332705 6:14736279-14736301 CCCATCAAAGTGAAACAGAAGGG No data
Right 1004332721 6:14736321-14736343 TAACCCATAAGCTTAAGGGTTGG No data
1004332705_1004332718 15 Left 1004332705 6:14736279-14736301 CCCATCAAAGTGAAACAGAAGGG No data
Right 1004332718 6:14736317-14736339 CCCCTAACCCATAAGCTTAAGGG No data
1004332705_1004332722 20 Left 1004332705 6:14736279-14736301 CCCATCAAAGTGAAACAGAAGGG No data
Right 1004332722 6:14736322-14736344 AACCCATAAGCTTAAGGGTTGGG No data
1004332705_1004332716 14 Left 1004332705 6:14736279-14736301 CCCATCAAAGTGAAACAGAAGGG No data
Right 1004332716 6:14736316-14736338 CCCCCTAACCCATAAGCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004332705 Original CRISPR CCCTTCTGTTTCACTTTGAT GGG (reversed) Intergenic
No off target data available for this crispr