ID: 1004332709

View in Genome Browser
Species Human (GRCh38)
Location 6:14736283-14736305
Sequence TCAAAGTGAAACAGAAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004332702_1004332709 -8 Left 1004332702 6:14736268-14736290 CCAAGGTGGACCCCATCAAAGTG No data
Right 1004332709 6:14736283-14736305 TCAAAGTGAAACAGAAGGGAGGG No data
1004332701_1004332709 5 Left 1004332701 6:14736255-14736277 CCAGAGAGTTTATCCAAGGTGGA No data
Right 1004332709 6:14736283-14736305 TCAAAGTGAAACAGAAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004332709 Original CRISPR TCAAAGTGAAACAGAAGGGA GGG Intergenic
No off target data available for this crispr