ID: 1004332714

View in Genome Browser
Species Human (GRCh38)
Location 6:14736292-14736314
Sequence AACAGAAGGGAGGGGTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004332703_1004332714 -9 Left 1004332703 6:14736278-14736300 CCCCATCAAAGTGAAACAGAAGG No data
Right 1004332714 6:14736292-14736314 AACAGAAGGGAGGGGTGGGGAGG No data
1004332705_1004332714 -10 Left 1004332705 6:14736279-14736301 CCCATCAAAGTGAAACAGAAGGG No data
Right 1004332714 6:14736292-14736314 AACAGAAGGGAGGGGTGGGGAGG No data
1004332701_1004332714 14 Left 1004332701 6:14736255-14736277 CCAGAGAGTTTATCCAAGGTGGA No data
Right 1004332714 6:14736292-14736314 AACAGAAGGGAGGGGTGGGGAGG No data
1004332702_1004332714 1 Left 1004332702 6:14736268-14736290 CCAAGGTGGACCCCATCAAAGTG No data
Right 1004332714 6:14736292-14736314 AACAGAAGGGAGGGGTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004332714 Original CRISPR AACAGAAGGGAGGGGTGGGG AGG Intergenic
No off target data available for this crispr