ID: 1004332716

View in Genome Browser
Species Human (GRCh38)
Location 6:14736316-14736338
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004332702_1004332716 25 Left 1004332702 6:14736268-14736290 CCAAGGTGGACCCCATCAAAGTG No data
Right 1004332716 6:14736316-14736338 CCCCCTAACCCATAAGCTTAAGG No data
1004332703_1004332716 15 Left 1004332703 6:14736278-14736300 CCCCATCAAAGTGAAACAGAAGG No data
Right 1004332716 6:14736316-14736338 CCCCCTAACCCATAAGCTTAAGG No data
1004332707_1004332716 13 Left 1004332707 6:14736280-14736302 CCATCAAAGTGAAACAGAAGGGA No data
Right 1004332716 6:14736316-14736338 CCCCCTAACCCATAAGCTTAAGG No data
1004332705_1004332716 14 Left 1004332705 6:14736279-14736301 CCCATCAAAGTGAAACAGAAGGG No data
Right 1004332716 6:14736316-14736338 CCCCCTAACCCATAAGCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004332716 Original CRISPR CCCCCTAACCCATAAGCTTA AGG Intergenic
No off target data available for this crispr