ID: 1004333129

View in Genome Browser
Species Human (GRCh38)
Location 6:14739827-14739849
Sequence ATCTTCCAGCAGAATCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004333124_1004333129 17 Left 1004333124 6:14739787-14739809 CCCTGCCTAGGGAGGTCAACAAA No data
Right 1004333129 6:14739827-14739849 ATCTTCCAGCAGAATCTTGAAGG No data
1004333125_1004333129 16 Left 1004333125 6:14739788-14739810 CCTGCCTAGGGAGGTCAACAAAA No data
Right 1004333129 6:14739827-14739849 ATCTTCCAGCAGAATCTTGAAGG No data
1004333126_1004333129 12 Left 1004333126 6:14739792-14739814 CCTAGGGAGGTCAACAAAACAAC No data
Right 1004333129 6:14739827-14739849 ATCTTCCAGCAGAATCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004333129 Original CRISPR ATCTTCCAGCAGAATCTTGA AGG Intergenic
No off target data available for this crispr