ID: 1004337486

View in Genome Browser
Species Human (GRCh38)
Location 6:14777430-14777452
Sequence GAGACCAGGAGGAATCGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004337486_1004337492 22 Left 1004337486 6:14777430-14777452 CCTGCTCGATTCCTCCTGGTCTC No data
Right 1004337492 6:14777475-14777497 TAATAGCTCTCAGTACCTATTGG 0: 1
1: 0
2: 0
3: 1
4: 88
1004337486_1004337493 23 Left 1004337486 6:14777430-14777452 CCTGCTCGATTCCTCCTGGTCTC No data
Right 1004337493 6:14777476-14777498 AATAGCTCTCAGTACCTATTGGG No data
1004337486_1004337489 -9 Left 1004337486 6:14777430-14777452 CCTGCTCGATTCCTCCTGGTCTC No data
Right 1004337489 6:14777444-14777466 CCTGGTCTCTCCCGACACAGTGG No data
1004337486_1004337494 24 Left 1004337486 6:14777430-14777452 CCTGCTCGATTCCTCCTGGTCTC No data
Right 1004337494 6:14777477-14777499 ATAGCTCTCAGTACCTATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004337486 Original CRISPR GAGACCAGGAGGAATCGAGC AGG (reversed) Intergenic