ID: 1004337487

View in Genome Browser
Species Human (GRCh38)
Location 6:14777441-14777463
Sequence CTGTGTCGGGAGAGACCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004337487_1004337492 11 Left 1004337487 6:14777441-14777463 CCTCCTGGTCTCTCCCGACACAG No data
Right 1004337492 6:14777475-14777497 TAATAGCTCTCAGTACCTATTGG No data
1004337487_1004337493 12 Left 1004337487 6:14777441-14777463 CCTCCTGGTCTCTCCCGACACAG No data
Right 1004337493 6:14777476-14777498 AATAGCTCTCAGTACCTATTGGG No data
1004337487_1004337494 13 Left 1004337487 6:14777441-14777463 CCTCCTGGTCTCTCCCGACACAG No data
Right 1004337494 6:14777477-14777499 ATAGCTCTCAGTACCTATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004337487 Original CRISPR CTGTGTCGGGAGAGACCAGG AGG (reversed) Intergenic