ID: 1004337492

View in Genome Browser
Species Human (GRCh38)
Location 6:14777475-14777497
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 88}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004337486_1004337492 22 Left 1004337486 6:14777430-14777452 CCTGCTCGATTCCTCCTGGTCTC No data
Right 1004337492 6:14777475-14777497 TAATAGCTCTCAGTACCTATTGG 0: 1
1: 0
2: 0
3: 1
4: 88
1004337488_1004337492 8 Left 1004337488 6:14777444-14777466 CCTGGTCTCTCCCGACACAGTGG No data
Right 1004337492 6:14777475-14777497 TAATAGCTCTCAGTACCTATTGG 0: 1
1: 0
2: 0
3: 1
4: 88
1004337490_1004337492 -2 Left 1004337490 6:14777454-14777476 CCCGACACAGTGGTACAGACTTA No data
Right 1004337492 6:14777475-14777497 TAATAGCTCTCAGTACCTATTGG 0: 1
1: 0
2: 0
3: 1
4: 88
1004337491_1004337492 -3 Left 1004337491 6:14777455-14777477 CCGACACAGTGGTACAGACTTAA No data
Right 1004337492 6:14777475-14777497 TAATAGCTCTCAGTACCTATTGG 0: 1
1: 0
2: 0
3: 1
4: 88
1004337487_1004337492 11 Left 1004337487 6:14777441-14777463 CCTCCTGGTCTCTCCCGACACAG No data
Right 1004337492 6:14777475-14777497 TAATAGCTCTCAGTACCTATTGG 0: 1
1: 0
2: 0
3: 1
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004337492 Original CRISPR TAATAGCTCTCAGTACCTAT TGG Intergenic