ID: 1004337493

View in Genome Browser
Species Human (GRCh38)
Location 6:14777476-14777498
Sequence AATAGCTCTCAGTACCTATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004337490_1004337493 -1 Left 1004337490 6:14777454-14777476 CCCGACACAGTGGTACAGACTTA No data
Right 1004337493 6:14777476-14777498 AATAGCTCTCAGTACCTATTGGG No data
1004337488_1004337493 9 Left 1004337488 6:14777444-14777466 CCTGGTCTCTCCCGACACAGTGG No data
Right 1004337493 6:14777476-14777498 AATAGCTCTCAGTACCTATTGGG No data
1004337487_1004337493 12 Left 1004337487 6:14777441-14777463 CCTCCTGGTCTCTCCCGACACAG No data
Right 1004337493 6:14777476-14777498 AATAGCTCTCAGTACCTATTGGG No data
1004337486_1004337493 23 Left 1004337486 6:14777430-14777452 CCTGCTCGATTCCTCCTGGTCTC No data
Right 1004337493 6:14777476-14777498 AATAGCTCTCAGTACCTATTGGG No data
1004337491_1004337493 -2 Left 1004337491 6:14777455-14777477 CCGACACAGTGGTACAGACTTAA No data
Right 1004337493 6:14777476-14777498 AATAGCTCTCAGTACCTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004337493 Original CRISPR AATAGCTCTCAGTACCTATT GGG Intergenic