ID: 1004338227

View in Genome Browser
Species Human (GRCh38)
Location 6:14783826-14783848
Sequence GCCGGCCGGCCCGCAAGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004338227_1004338231 -4 Left 1004338227 6:14783826-14783848 CCGGGGCTTGCGGGCCGGCCGGC No data
Right 1004338231 6:14783845-14783867 CGGCTTGCCGTTCCGAGTGCGGG No data
1004338227_1004338230 -5 Left 1004338227 6:14783826-14783848 CCGGGGCTTGCGGGCCGGCCGGC No data
Right 1004338230 6:14783844-14783866 CCGGCTTGCCGTTCCGAGTGCGG No data
1004338227_1004338232 -3 Left 1004338227 6:14783826-14783848 CCGGGGCTTGCGGGCCGGCCGGC No data
Right 1004338232 6:14783846-14783868 GGCTTGCCGTTCCGAGTGCGGGG No data
1004338227_1004338236 20 Left 1004338227 6:14783826-14783848 CCGGGGCTTGCGGGCCGGCCGGC No data
Right 1004338236 6:14783869-14783891 CCACTGAGTCCACGCCCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004338227 Original CRISPR GCCGGCCGGCCCGCAAGCCC CGG (reversed) Intergenic
No off target data available for this crispr