ID: 1004338742 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:14788353-14788375 |
| Sequence | CAGTGTGATCCGTGGCCAAA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1004338738_1004338742 | 23 | Left | 1004338738 | 6:14788307-14788329 | CCAGGTCAGTTCTAGGACAGCAT | No data | ||
| Right | 1004338742 | 6:14788353-14788375 | CAGTGTGATCCGTGGCCAAATGG | No data | ||||
| 1004338736_1004338742 | 30 | Left | 1004338736 | 6:14788300-14788322 | CCTCTCTCCAGGTCAGTTCTAGG | No data | ||
| Right | 1004338742 | 6:14788353-14788375 | CAGTGTGATCCGTGGCCAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1004338742 | Original CRISPR | CAGTGTGATCCGTGGCCAAA TGG | Intergenic | ||
| No off target data available for this crispr | |||||