ID: 1004338742

View in Genome Browser
Species Human (GRCh38)
Location 6:14788353-14788375
Sequence CAGTGTGATCCGTGGCCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004338738_1004338742 23 Left 1004338738 6:14788307-14788329 CCAGGTCAGTTCTAGGACAGCAT No data
Right 1004338742 6:14788353-14788375 CAGTGTGATCCGTGGCCAAATGG No data
1004338736_1004338742 30 Left 1004338736 6:14788300-14788322 CCTCTCTCCAGGTCAGTTCTAGG No data
Right 1004338742 6:14788353-14788375 CAGTGTGATCCGTGGCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004338742 Original CRISPR CAGTGTGATCCGTGGCCAAA TGG Intergenic
No off target data available for this crispr