ID: 1004347012

View in Genome Browser
Species Human (GRCh38)
Location 6:14857825-14857847
Sequence GGTGGAAGTGGGGGCGCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004347012_1004347025 9 Left 1004347012 6:14857825-14857847 CCACCGGCGCCCCCACTTCCACC No data
Right 1004347025 6:14857857-14857879 AGCAAGAGACTGGAACTCTGAGG No data
1004347012_1004347021 -1 Left 1004347012 6:14857825-14857847 CCACCGGCGCCCCCACTTCCACC No data
Right 1004347021 6:14857847-14857869 CCCCGCCTTCAGCAAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004347012 Original CRISPR GGTGGAAGTGGGGGCGCCGG TGG (reversed) Intergenic
No off target data available for this crispr