ID: 1004347025

View in Genome Browser
Species Human (GRCh38)
Location 6:14857857-14857879
Sequence AGCAAGAGACTGGAACTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004347006_1004347025 28 Left 1004347006 6:14857806-14857828 CCGCATCTCACACGTCCCCCCAC No data
Right 1004347025 6:14857857-14857879 AGCAAGAGACTGGAACTCTGAGG No data
1004347016_1004347025 -2 Left 1004347016 6:14857836-14857858 CCCACTTCCACCCCCGCCTTCAG No data
Right 1004347025 6:14857857-14857879 AGCAAGAGACTGGAACTCTGAGG No data
1004347011_1004347025 10 Left 1004347011 6:14857824-14857846 CCCACCGGCGCCCCCACTTCCAC No data
Right 1004347025 6:14857857-14857879 AGCAAGAGACTGGAACTCTGAGG No data
1004347015_1004347025 -1 Left 1004347015 6:14857835-14857857 CCCCACTTCCACCCCCGCCTTCA No data
Right 1004347025 6:14857857-14857879 AGCAAGAGACTGGAACTCTGAGG No data
1004347008_1004347025 13 Left 1004347008 6:14857821-14857843 CCCCCCACCGGCGCCCCCACTTC No data
Right 1004347025 6:14857857-14857879 AGCAAGAGACTGGAACTCTGAGG No data
1004347012_1004347025 9 Left 1004347012 6:14857825-14857847 CCACCGGCGCCCCCACTTCCACC No data
Right 1004347025 6:14857857-14857879 AGCAAGAGACTGGAACTCTGAGG No data
1004347017_1004347025 -3 Left 1004347017 6:14857837-14857859 CCACTTCCACCCCCGCCTTCAGC No data
Right 1004347025 6:14857857-14857879 AGCAAGAGACTGGAACTCTGAGG No data
1004347013_1004347025 6 Left 1004347013 6:14857828-14857850 CCGGCGCCCCCACTTCCACCCCC No data
Right 1004347025 6:14857857-14857879 AGCAAGAGACTGGAACTCTGAGG No data
1004347005_1004347025 29 Left 1004347005 6:14857805-14857827 CCCGCATCTCACACGTCCCCCCA No data
Right 1004347025 6:14857857-14857879 AGCAAGAGACTGGAACTCTGAGG No data
1004347018_1004347025 -9 Left 1004347018 6:14857843-14857865 CCACCCCCGCCTTCAGCAAGAGA No data
Right 1004347025 6:14857857-14857879 AGCAAGAGACTGGAACTCTGAGG No data
1004347009_1004347025 12 Left 1004347009 6:14857822-14857844 CCCCCACCGGCGCCCCCACTTCC No data
Right 1004347025 6:14857857-14857879 AGCAAGAGACTGGAACTCTGAGG No data
1004347014_1004347025 0 Left 1004347014 6:14857834-14857856 CCCCCACTTCCACCCCCGCCTTC No data
Right 1004347025 6:14857857-14857879 AGCAAGAGACTGGAACTCTGAGG No data
1004347010_1004347025 11 Left 1004347010 6:14857823-14857845 CCCCACCGGCGCCCCCACTTCCA No data
Right 1004347025 6:14857857-14857879 AGCAAGAGACTGGAACTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004347025 Original CRISPR AGCAAGAGACTGGAACTCTG AGG Intergenic
No off target data available for this crispr