ID: 1004351794

View in Genome Browser
Species Human (GRCh38)
Location 6:14896615-14896637
Sequence GATCCCTCCCACACTGACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004351788_1004351794 28 Left 1004351788 6:14896564-14896586 CCTGGATGGCCTCCAATAACCTA No data
Right 1004351794 6:14896615-14896637 GATCCCTCCCACACTGACTCTGG No data
1004351790_1004351794 16 Left 1004351790 6:14896576-14896598 CCAATAACCTACTTCTTTTCATA No data
Right 1004351794 6:14896615-14896637 GATCCCTCCCACACTGACTCTGG No data
1004351791_1004351794 9 Left 1004351791 6:14896583-14896605 CCTACTTCTTTTCATAGTCACCA No data
Right 1004351794 6:14896615-14896637 GATCCCTCCCACACTGACTCTGG No data
1004351789_1004351794 19 Left 1004351789 6:14896573-14896595 CCTCCAATAACCTACTTCTTTTC No data
Right 1004351794 6:14896615-14896637 GATCCCTCCCACACTGACTCTGG No data
1004351787_1004351794 29 Left 1004351787 6:14896563-14896585 CCCTGGATGGCCTCCAATAACCT No data
Right 1004351794 6:14896615-14896637 GATCCCTCCCACACTGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004351794 Original CRISPR GATCCCTCCCACACTGACTC TGG Intergenic
No off target data available for this crispr