ID: 1004352389

View in Genome Browser
Species Human (GRCh38)
Location 6:14901760-14901782
Sequence CAATCAGAGCACAGGGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004352384_1004352389 9 Left 1004352384 6:14901728-14901750 CCACAGGTTCTCAGTTATAAGCG No data
Right 1004352389 6:14901760-14901782 CAATCAGAGCACAGGGACACAGG No data
1004352383_1004352389 16 Left 1004352383 6:14901721-14901743 CCAAACACCACAGGTTCTCAGTT No data
Right 1004352389 6:14901760-14901782 CAATCAGAGCACAGGGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004352389 Original CRISPR CAATCAGAGCACAGGGACAC AGG Intergenic
No off target data available for this crispr