ID: 1004353641

View in Genome Browser
Species Human (GRCh38)
Location 6:14912578-14912600
Sequence CTGCCTGACCACTGTGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004353641_1004353648 7 Left 1004353641 6:14912578-14912600 CCCCACACACAGTGGTCAGGCAG No data
Right 1004353648 6:14912608-14912630 GTAACAGAGGTCCGCAGGCATGG No data
1004353641_1004353650 28 Left 1004353641 6:14912578-14912600 CCCCACACACAGTGGTCAGGCAG No data
Right 1004353650 6:14912629-14912651 GGCCTGCCACCATTGCCTGCAGG No data
1004353641_1004353646 -6 Left 1004353641 6:14912578-14912600 CCCCACACACAGTGGTCAGGCAG No data
Right 1004353646 6:14912595-14912617 AGGCAGGTGGTATGTAACAGAGG No data
1004353641_1004353647 2 Left 1004353641 6:14912578-14912600 CCCCACACACAGTGGTCAGGCAG No data
Right 1004353647 6:14912603-14912625 GGTATGTAACAGAGGTCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004353641 Original CRISPR CTGCCTGACCACTGTGTGTG GGG (reversed) Intergenic