ID: 1004356442

View in Genome Browser
Species Human (GRCh38)
Location 6:14933520-14933542
Sequence CTGAGGGTGGGAAGGCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004356434_1004356442 6 Left 1004356434 6:14933491-14933513 CCAAGGGCTAAGGGGAGGGGAGA No data
Right 1004356442 6:14933520-14933542 CTGAGGGTGGGAAGGCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004356442 Original CRISPR CTGAGGGTGGGAAGGCCAGA GGG Intergenic
No off target data available for this crispr